Building phylogenetic trees usually require multiple genes and the supermatrix approach is one of the popular ways to incorporate the information. However, the preparation of supermatrix is not straightforward and error-prone. The phylotools package aims to simplify the preparation of supermatrix. It automatically concatenated different gene markers by their names, i.e., building supermatrices based on the aligned Fasta or Phylip files.
The resulted supermatrices files are in the Relaxed Phylip format, a format that could be used in RAxML and IQ-Tree. The Relaxed Phylip format is an extension of the strict Phylip format, i.e., the two numbers in the first line show the number of sequences and the number of base pairs (bp), respectively, with a white-space in between. The second line starts with the sequence name, and between the sequence name and the nucleotide sequences, there is a white-space. In the strict Phylip format, each sequence name only allows 10 characters, software such as Phylip (https://evolution.genetics.washington.edu/phylip.html) will truncate the name and only take the first 10 characters if there are more than 10. The Relaxed Phylip format does not have this limitation and the names can contain as long as 128 characters.
Why is it necessary to use multiple gene markers to build an evolutionary tree? This is mainly because the individual genes markers are generally too short to fully reflect the relationships of the species, and building more accurate evolutionary trees generally requires longer sequences. Obtaining DNA barcoding markers became relatively easy from the year 2005 on wards, and these markers are suitable for building large phylogenies.
DNA barcoding sequences are generally obtained by the traditional Sanger sequencing method based on PCR products. rbcLa (Ribulose bisphosphate carboxylase large chain), matK (Megakaryocyte-Associated Tyrosine Kinase) and trnH-psbA (intergenic spacer region) are among the most commonly used DNA barcoding markers, and they all derived from the chloroplast genome. Other markers, such as ITS (Internal transcribed spacer), are also commonly used.
The mutation rates could vary greatly among different genes. Some genes are more stable and the differences between families and genera could be very minor, while others mutate rapidly and could be very different even among populations/individuals of the same species. For example, rbcLa is commonly used to locate the family a taxon belongs to, while matK could locate the genus or even species. Non-coding genes with very fast mutation rates, such as the trnH-psbA, are often used to determine species or subspecies. Using partitioned model during phylogenetic inferences is recommended.
Ideally, all the markers of a species should be obtained. However,
some sequences of some species may not always be amplified or sequenced
successfully, resulting in missing data. These missing loci will be
denoted as ? in the supermatrix.
In addition to phylotools, the following software can also be used to build supermatrix.
In which Genious has a graphical interface.
phylotools is written entirely in R and is easy to
use.phylotools assumes that the same species has the same
name in different fasta or phylip files.phylotools can recognize the aligned fasta or phylip
files, and the generated supermatrix is saved in the Relaxed Phylip
format.The latest version of phylotools is stored on github and
has not been uploaded to CRAN. Use the following command to install.
If devtools has not been installed, you can use
install.packages("devtools") to install.
clean.fasta.name removes special characters from fasta
sequence names so that they can be entered and displayed properly when
building treesdat2fasta converts DNA sequences data.frame to fasta
filesdat2phylip converts DNA sequences data.frame to phylip
filesget.fasta.name obtains the names of all sequences in
the fasta fileget.phylip.name obtains the names of all sequences in
the phylip fileread.fasta reads the fasta fileread.phylip reads the phylip filerename.fasta renames the sequences within a fasta file
according to a data frame supplied.rm.sequence.fasta removes a specific sequence from a
fasta filesplit_dat splits the data into separate fasta files
based on the grouping of the sequence, e.g., for trnH-psbA sequences
grouped by Orders (a taxonomic rank).sub.taxa.label substitutes the taxa name in the
phylogenetic tree (a phylo object of ape)supermat creates supermatrix and RAxML partition files
from aligned fasta or phylip files.Suppose there are three Phylip files encoding different genes, create the supermatrix of the three genes and save them in Relaxed Phylip format, and generate RAxML Partition File to record the start and end loci of each gene.
The corresponding codes are as follows.
library(phylotools)
#> Loading required package: ape
cat("6 22",
"seq_1 --TTACAAATTGACTTATTATA",
"seq_2 GATTACAAATTGACTTATTATA",
"seq_3 GATTACAAATTGACTTATTATA",
"seq_5 GATTACAAATTGACTTATTATA",
"seq_8 GATTACAAATTGACTTATTATA",
"seq_10 ---TACAAATTGAATTATTATA",
file = "matk.phy", sep = "\n")
cat("5 15",
"seq_1 GATTACAAATTGACT",
"seq_3 GATTACAAATTGACT",
"seq_4 GATTACAAATTGACT",
"seq_5 GATTACAAATTGACT",
"seq_8 GATTACAAATTGACT",
file = "rbcla.phy", sep = "\n")
cat("5 50",
"seq_2 GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
"seq_3 GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
"seq_5 GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
"seq_8 ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
"seq_9 ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.phy", sep = "\n")
supermat(infiles = c("matk.phy", "rbcla.phy", "trn1.phy"))
#> Supermatrix "supermat.out.fas" and RAxML partition file "gene_partition.txt" have been saved to:
#> /tmp/Rtmp5TakYi/Rbuild70e3c30e71b/phylotools/vignettesTo generate a supermatrix using a matched fasta file, the command is changed to the corresponding fasta file name.
library(phylotools)
cat(
">seq_1", "--TTACAAATTGACTTATTATA",
">seq_2", "GATTACAAATTGACTTATTATA",
">seq_3", "GATTACAAATTGACTTATTATA",
">seq_5", "GATTACAAATTGACTTATTATA",
">seq_8", "GATTACAAATTGACTTATTATA",
">seq_10", "---TACAAATTGAATTATTATA",
file = "matk.fasta", sep = "\n")
cat(
">seq_1", "GATTACAAATTGACT",
">seq_3", "GATTACAAATTGACT",
">seq_4", "GATTACAAATTGACT",
">seq_5", "GATTACAAATTGACT",
">seq_8", "GATTACAAATTGACT",
file = "rbcla.fasta", sep = "\n")
cat(
">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.fasta", sep = "\n")
supermat(infiles = c("matk.fasta", "rbcla.fasta", "trn1.fasta"))
#> Supermatrix "supermat.out.fas" and RAxML partition file "gene_partition.txt" have been saved to:
#> /tmp/Rtmp5TakYi/Rbuild70e3c30e71b/phylotools/vignettes
citation("phylotools")
#> To cite package 'phylotools' in publications use:
#>
#> Zhang J (2024). _phylotools: Phylogenetic Tools for
#> Eco-Phylogenetics_. R package version 0.2.5,
#> <https://github.com/helixcn/phylotools>.
#>
#> A BibTeX entry for LaTeX users is
#>
#> @Manual{,
#> title = {phylotools: Phylogenetic Tools for Eco-Phylogenetics},
#> author = {Jinlong Zhang},
#> year = {2024},
#> note = {R package version 0.2.5},
#> url = {https://github.com/helixcn/phylotools},
#> }